Solution structure of the d(T-C-G-A) duplex at acidic pH. A parallel-stranded helix containing C+ .C, G.G and A.A pairs

The solution structure of the d(T-C-G-A) sequence at acidic pH has been determined by a combination of NMR and molecular dynamics calculations including NOE intensity based refinements. This sequence forms a right-handed parallel-stranded duplex with C+ .C (three hydrogen bonds along Watson-Crick edge), G.G (two symmetry related N2-H.. N3 hydrogen bonds) and A.A (two symmetry related N6-H..N7 hydrogen bonds) homo base-pair formation at acidic pH. The duplex is stabilized by intra-strand base stacking at the C2-G3 step and cross-strand base stacking at the G3-A4 step. The thymine residues on partner strands are directed towards each other and are positioned over the C+ .C base-pair. All four residues adopt anti glycosidic torsion angles and C2'-endo type sugar conformations in the parallel-stranded d(T-C-G-A) duplex which exhibits large changes in twist angles between adjacent steps along the duplex. This study rules out previously proposed models for the structure of the d(T-C-G-A) duplex at acidic pH and supports earlier structural contributions, which established that d(C-G) and d(C-G-A) containing sequences at acidic pH pair through parallel-stranded alignment. We have also monitored hydration patterns in the symmetry related grooves of the parallel-stranded d(T-C-G-A) duplex.     

Cytosine-cytosine+ base pairing stabilizes DNA quadruplexes and cytosine methylation greatly enhances the effect

Previous spectroscopic studies demonstrated that the oligodeoxynucleotide d(CGC G3 GCG) undergoes a reversible cation-dependent transition between Watson-Crick (WC) hairpin and parallel-stranded "G-DNA" quadruplex structures [Hardin, C.C., Watson, T., Corregan, M., & Bailey, C. (1992) Biochemistry 31, 833-841]. The relative stabilities of the structures were assessed as a function of pH, and it was found that the quadruplex was substantially stabilized (delta Tm = +15 degrees C) when the pH was shifted from 7.5 to 6 (apparent pKa = 6.8). In the present study, the effects of different cations and pH on four specific sequence varients were determined to test the proposal that this stabilization is due to C.C+ base pair formation mediated by N3-protonation of cytosine. Characteristically large differences in stability were observed when structures formed by d(TAT G3 ATA) and d(TAT G4 ATA) were thermally dissociated at pH 7 in the presence of different cations, verifying that Gn tracts bordered by TAT- and -ATA sequences form quadruplex structures. Imino proton NMR results indicate that the d(m5C G m5C G3 G m5C G)4 and d(TAT G4 ATA)4 quadruplex structures are parallel-stranded. It was necessary to increase the K+ concentration from 40 mM to ca. 200 mM to stabilize d(TAT G3 ATA)4, while the d(TAT G4 ATA)4 complex was nearly as stable as the quadruplex formed by d(CGC G3 GCG) under the same conditions. The d(TAT G4 ATA)4 quadruplex was only slightly stabilized at pH 6 relative to pH 7.5 (delta Tm = +3 degrees C), confirming that the unique stabilization that occurs in the pH 6.8 range with [d(CGC Gn GCG)4.ionn] complexes is due to the C residues. The sequence d(m5C G m5C G3 G m5C G) was found to form a very stable quadruplex in K+ or Ca2+. As with the quadruplex formed by the unmethylated analog, the stability is greatly enhanced when the pH is decreased below about 7.2 (pKa,obs = 6.8). Dissociation kinetic constants and activation energies were determined for quadruplexes formed by d(CGC G3 GCG), d(m5C G m5C G3 G m5C G) and d(TAT G4 ATA). Quantitative comparisons showed that methylation produces a complex that is much more stable at pH 7 in 40 mM Na+ than either of the unmodified structures; the rate-limiting activation energy for dissociation of d(CGC G3 GCG)4 was 22 kcal mol-1 less than for the methylated analog.(ABSTRACT TRUNCATED AT 400 WORDS)     

Thermodynamic consequences of an abasic lesion in duplex DNA are strongly dependent on base sequence

The abasic site in DNA may arise spontaneously, as a result of nucleotide base damage, or as an intermediate in glycosylase-mediated DNA-repair pathways. It is the most common damage found in DNA. We have examined the consequences of this lesion and its sequence context on DNA duplex structure, as well as the thermal and thermodynamic stability of the duplex, including the energetic origins of that stability. To this end, we incorporated a tetrahydrofuran abasic site analogue into a family of 13-mer DNA duplexes, wherein the base opposite the lesion (A, C, G, or T) and the base pairs neighboring the lesion (C.G or G.C) were systematically varied and characterized by a combination of spectroscopic and calorimetric techniques. The resulting data allowed us to reach the following conclusions: (i) the presence of the lesion in all sequence contexts studied does not alter the global B-form conformation characteristic of the parent undamaged duplex; (ii) the presence of the lesion induces a significant enthalpic destabilization of the duplex, with the magnitude of this effect being dependent on the sequence context; (iii) the thermodynamic impact of the lesion is dominated by the identity of the neighboring base pairs, with the cross strand partner base exerting only a secondary thermodynamic effect on duplex properties. In the aggregate, our data reveal that even in the absence of lesion-induced alterations in global structure, the abasic lesion can significantly alter the thermodynamic properties of the host duplex, with the magnitude of this impact being strongly dependent on sequence context.     

Topoisomerase II-mediated DNA cleavage and religation in the absence of base pairing. Abasic lesions as a tool to dissect enzyme mechanism

The interaction of topoisomerase II with its DNA cleavage site is critical to the physiological functions of the enzyme. Despite this importance, the specific enzyme-DNA interactions that drive topoisomerase II-mediated DNA cleavage and religation are poorly understood. Therefore, to dissect interactions between the enzyme and its cleavage site, abasic DNA lesions were incorporated into a bilaterally symmetrical and identical cleavage site. Results indicate that topoisomerase II has unique interactions with each position of the 4-base overhang generated by enzyme-mediated DNA cleavage. Lesions located 2 bases 3' to the point of scission stimulated cleavage the most, whereas those 3 bases from the point of scission stimulated cleavage the least. Moreover, an additive and in some cases synergistic cleavage enhancement was observed in oligonucleotides that contained multiple DNA lesions, with levels reaching >60-fold higher than the wild-type substrate. Finally, topoisomerase II efficiently cleaved and religated a DNA substrate in which apyrimidinic sites were simultaneously incorporated at every position on one strand of the 4-base overhang. Therefore, unlike classical DNA ligases in which base pairing is the driving force behind closure of the DNA break, it appears that for topoisomerase II, the enzyme is responsible for the spatial orientation of the DNA termini for ligation.     

Role of partner homology in DNA recombination. Complementary base pairing orients the 5'-hydroxyl for strand joining during Flp site-specific recombination

Absolute homology between partner substrates within the strand exchange region is an essential requirement for recombination mediated by the yeast site-specific recombinase Flp. Using combinations of specially designed half- and full-site Flp substrates, we demonstrate that the strand joining step of recombination is exquisitely sensitive to spacer homology. At each exchange point, 2-3 spacer nucleotides adjacent to the nick within the cleaved strand of one substrate must base pair with the corresponding segment of the un-nicked strand from the second substrate for efficient strand joining in the recombinant mode. In accordance with the "cis-activation/trans-nucleophilic attack" model for each of the two transesterification steps of Flp recombination (strand cleavage and strand joining), we propose that the limited strand pairing orients the DNA-nucleophile (5'-hydroxyl) for attack on its target diester (3'-phosphotyrosyl-Flp). During one round of recombination, 4-6 terminal base pairs of the spacer (2-3 base pairs at each spacer end) must unpair, following strand cleavage, within a DNA substrate and pair with the partner substrate prior to strand union. In this model, the extent of branch migration of the covalently closed Holliday intermediate is limited to the central core of the spacer. The templated positioning of reactive nucleic acid groups (which is central to the model) may be utilized by other recombination systems and by RNA splicing reactions.     

Human replication protein A preferentially binds cisplatin-damaged duplex DNA in vitro

Fractionation of human cell extracts by cisplatin-DNA affinity chromatography was employed to identify proteins capable of binding cisplatin-damaged DNA. A specific protein-DNA complex, termed DRP-3, was identified in an electrophoretic mobility shift assay (EMSA) using a cisplatin-damaged DNA probe. Using this assay we purified DRP-3 and the final fraction contained proteins of 70, 53, 46, 32, and 14 kDa. On the basis of subunit molecular weights, antibody reactivity, and DNA binding activities, DRP-3 was identified as human replication protein A (hRPA). Therefore, we assessed the binding of recombinant human RPA (rhRPA) to duplex cisplatin-damaged DNA in vitro. Global treatment of a highly purified completely duplex 44-bp DNA with cisplatin resulted in a 10-20-fold increase in rhRPA binding compared to the undamaged control. The stability of the RPA-DNA complexes was assessed, and NaCl and MgCl2 concentrations that completely inhibited rhRPA binding to undamaged DNA had only a minimal effect on binding to duplex platinated DNA. We assessed rhRPA binding to a duplex DNA containing a single site-specific 1,2-d(GpG) cisplatin adduct, and the results revealed a 4-6-fold increase in binding to this DNA substrate compared to an undamaged control DNA of identical sequence. These results are consistent with RPA being involved in the initial recognition of cisplatin-damaged DNA, possibly mediating DNA repair events. Therefore, we assessed how another cisplatin DNA binding protein, HMG-1, affected the ability of rhRPA to bind damaged DNA. Competition binding assays show minimal dissociation of either protein from cisplatin-damaged DNA during the course of the reaction. Simultaneous addition experiments revealed that HMG-1 binding to cisplatin-damaged DNA was minimally affected by rhRPA, while HMG-1 inhibited the damaged-DNA binding activity of rhRPA. These data are consistent with HMG-1 blocking DNA repair and possibly having the capability to enhance the cytotoxic efficacy of the drug cisplatin.     

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.     

Induced-fit association between DNA and esperamicin. Importance of structural flexibility in host DNA duplex

In this study, a series of synthetic oligonucleotide duplexes are tested as a substrate for esperamicin. The duplexes contain a typical binding sequence of esperamicin, 5'-GGA/TCC, but have different flexibilities in helix structure from each other. When cleavage activities of these oligonucleotides by esperamicin were estimated by using DNA sequencing method, a substantial increase of the cleavage at 3'-NAGG was observed with increasing the helix flexibility. This observation indicates that structural flexibility of host DNA duplex is important in an induced-fit association between esperamicin and DNA.     

A novel mitochondrial DNA point mutation associated with mitochondrial encephalocardiomyopathy

A novel mitochondrial DNA (mtDNA) mutation at position nt 4320 in the tRNA(Ile) gene was associated with severe encephalopathy in a 7-month-old infant, who died of intractable hypertrophic cardiomyopathy. The mutation was present in heteroplasmic fashion (88%) in muscle and fulfills accepted criteria for pathogenicity. This is the fourth pathogenic mutation identified in this gene, which appears to be a "hotspot" for deleterious mutations affecting the heart. This report adds to the evidence of genetic heterogeneity in hypertrophic cardiomyopathies.     

Sequence-specific recognition of double helical RNA and RNA.DNA by triple helix formation

The stabilities of eight triple helical pyrimidine.purine.pyrimidine structures comprised of identical sequence but different RNA (R) or DNA (D) strand combinations were measured by quantitative affinity cleavage titration. The differences in equilibrium binding affinities reveal the importance of strand composition. For the sequences studied here, the stabilities of complexes containing a pyrimidine third strand D or R and purine.pyrimidine double helical DD, DR, RD, and RR decrease in order: D + DD, R + DD, R + DR, D + DR > R + RD, R + RR > D + RR, D + RD (pH 7.0, 25 degrees C, 100 mM NaCl/1 mM spermine). These findings suggest that RNA and DNA oligonucleotides will be useful for targeting (i) double helical DNA and (ii) RNA.DNA hybrids if the purine Watson-Crick strand is DNA. However, RNA, but not DNA, oligonucleotides will be useful for sequence-specific binding of (i) double helical RNA and (ii) RNA.DNA hybrids if the purine Watson-Crick strand is RNA. This has implications for the design of artificial ligands targeted to specific sequences of double helical RNA and RNA.DNA hybrids.     

NMR study of G.A and A.A pairing in (dGCGAATAAGCG)2

One- and two-dimensional NMR, UV absorption experiments, and molecular mechanics calculations were conducted on an oligonucleotide duplex (dGCGAATAAGCG)2 which will be referred to as the T-11-mer. This oligonucleotide forms a duplex that is primarily B-form and contains two adjacent G.A and A.A base pairs and two 3' unpaired guanosines. The adjacent mismatch base pairs have an unusual structure which includes overwinding the helix and stacking with the base from the complementary strand (A4 with A8 and G3 with A7) instead of stacking with the base which is sequential on the strand. The exchangeable and nonexchangeable proton NMR spectra of the duplex have been characterized in H2O and D2O solution at neutral and acidic pH. The duplex is stabilized upon protonation; however, no additional hydrogen bonds are formed. We have observed the amino protons of adenosines A4 and A8 and guanosine G3 as a function of temperature and pH. These amino protons are involved in hydrogen bonds with the purine N3 or N7 acting as acceptors. Through the observation of a variety of NOE signals, the structure of the G.A and A.A mismatch base pairs has been defined.     

DNA base composition of Allium genomes with different chromosome numbers

The aim of the present study was to analyze the fatty acid content of carious and sound human dentin. Gas chromatography and gas chromatography-mass spectrometry revealed the presence of fatty acids of C10-C18 size in the carious dentin, whereas fatty acids of C16 size were present in minute amounts in three samples of the corresponding sound dentine controls. No fatty acids were detected in the other sound dentin control samples. The source of fatty acids was considered to be microorganisms invading the dentin during the progression of the caries lesion. The presence of bacterial fatty acids in carious dentin may serve as a marker for the pathological process and thus contribute to the understanding of the mechanisms involved.     

Flavor preferences produced by backward pairing with wheel running.

In 3 experiments rats given 8 sessions of preexposure to wheel running acquired a preference for a flavor that was given immediately after each of 4 subsequent sessions of wheel running. Such flavor preference was less likely when rats were given the same conditioning procedure but without preexposure to wheels (Experiment 1) or when access to flavor was delayed by 30 min following a wheel session (Experiment 2). When rats were given a flavor before each wheel session, the resulting conditioned aversion was greater in rats that had no prior exposure to wheel running (Experiment 3). These results show that whether an aversion or preference for a flavor is produced by wheel running depends on an interaction between prior wheel experience and the sequence of events. (PsycINFO Database Record (c) 2010 APA, all rights reserved)     

Solution conformation of the (-)-trans-anti-[BP]dG adduct opposite a deletion site in a DNA duplex: intercalation of the covalently attached benzo[a]pyrene into the helix with base displacement of the modified deoxyguanosine into the minor groove

A combined NMR-computational approach was employed to determine the solution structure of the (-)-trans-anti-[BP]dG adduct positioned opposite a -1 deletion site in the d(C1-C2-A3-T4-C5- [BP]G6-C7-T8-A9-C10-C11).d(G12-G13-T14-A15-G1 6-G17-A18-T19-G20-G21) sequence context. The (-)-trans-anti-[BP]dG moiety is derived from the binding of the (-)-anti-benzo[a]pyrene diol epoxide [(-)-anti-BPDE] to N2 of dG6 and has a 10R absolute configuration at the [BP]dG linkage site. The exchangeable and non-exchangeable protons of the benzo[a]pyrenyl moiety and the nucleic acid were assigned following analysis of two-dimensional NMR data sets in H2O and D2O solution. The solution conformation has been determined by incorporating intramolecular and intermolecular proton-proton distances defined by lower and upper bounds deduced from NOESY spectra as restraints in molecular mechanics computations in torsion angle space followed by restrained molecular dynamics calculations based on a NOE distance and intensity refinement protocol. Our structural studies establish that the aromatic BP ring system intercalates into the helix opposite the deletion site, while the modified deoxyguanosine residue is displaced into the minor groove with its face parallel to the helix axis. The intercalation site is wedge-shaped and the BP aromatic ring system stacks over intact flanking Watson-Crick dG.dC base pairs. The modified deoxyguanosine stacks over the minor groove face of the sugar ring of the 5'-flanking dC5 residue. The BP moiety is positioned with the benzylic ring oriented toward the minor groove and the distal pyrenyl aromatic ring directed toward the major groove. This conformation strikingly contrasts with the corresponding structure in the full duplex with the same 10R (-)-trans-anti-[BP]dG lesion positioned opposite a complementary dC residue [de los Santos et al. (1992) Biochemistry 31, 5245-5252); in this case the aromatic BP ring system is located in the minor groove, and there is no disruption of the [BP]dG.dC Watson-Crick base pairing alignment. The intercalation-base displacement features of the 10R (-)-trans-anti-[BP]dG adduct opposite a deletion site have features in common to those of the 10S (+)-trans-anti-[BP]dG adduct opposite a deletion site previously reported by Cosman et al. [(1994)(Biochemistry 33, 11507-11517], except that there is a nearly 180 degrees rotation of the BP residue about the axis of the helix at the base-displaced intercalation site and the modified deoxyguanosine is positioned in the opposite groove. In the 10S adduct, the benzylic ring is in the major groove and the aromatic ring systems point toward the minor groove. This work extends the theme of opposite orientations of adducts derived from chiral pairs of (+)- and (-)-anti-BPDE enantiomers; both 10S and 10R adducts can be positioned with opposite orientations either in the minor groove or at base displaced intercalation sites, depending on the presence or absence of the partner dC base in the complementary strand.     

A novel DNA polymerase family found in Archaea

One of the most puzzling results from the complete genome sequence of the methanogenic archaeon Methanococcus jannaschii was that the organism may have only one DNA polymerase gene. This is because no other DNA polymerase-like open reading frames (ORFs) were found besides one ORF having the typical alpha-like DNA polymerase (family B). Recently, we identified the genes of DNA polymerase II (the second DNA polymerase) from the hyperthermophilic archaeon Pyrococcus furiosus, which has also at least one alpha-like DNA polymerase (T. Uemori, Y. Sato, I. Kato, H. Doi, and Y. Ishino, Genes Cells 2:499-512, 1997). The genes in M. jannaschii encoding the proteins that are homologous to the DNA polymerase II of P. furiosus have been located and cloned. The gene products of M. jannaschii expressed in Escherichia coli had both DNA polymerizing and 3'-->5' exonuclease activities. We propose here a novel DNA polymerase family which is entirely different from other hitherto-described DNA polymerases.     

A zipper-like duplex in DNA: the crystal structure of d(GCGAAAGCT) at 2.1 A resolution

BACKGROUND: The replication origin of the single-stranded (ss)DNA bacteriophage G4 has been proposed to fold into a hairpin loop containing the sequence GCGAAAGC. This sequence comprises a purine-rich motif (GAAA), which also occurs in conserved repetitive sequences of centromeric DNA. ssDNA analogues of these sequences often show exceptional stability which is associated with hairpin loops or unusual duplexes, and may be important in DNA replication and centromere function. Nuclear magnetic resonance (NMR) studies indicate that the GCGAAAGC sequence forms a hairpin loop in solution, while centromere-like repeats dimerise into unusual duplexes. The factors stabilising these unusual secondary structure elements in ssDNA, however, are poorly understood. RESULTS: The nonamer d(GCGAAAGCT) was crystallised as a bromocytosine derivative in the presence of cobalt hexammine. The crystal structure, solved by the multiple wavelength anomalous dispersion (MAD) method at the bromine K-edge, reveals an unexpected zipper-like motif in the middle of a standard B-DNA duplex. Four central adenines, flanked by two sheared G.A mismatches, are intercalated and stacked on top of each other without any interstrand Watson-Crick base pairing. The cobalt hexammine cation appears to participate only in crystal cohesion. CONCLUSIONS: The GAAA consensus sequence can dimerise into a stable zipper-like duplex as well as forming a hairpin loop. The arrangement closes the minor groove and exposes the intercalated, unpaired, adenines to the solvent and DNA-binding proteins. Such a motif, which can transform into a hairpin, should be considered as a structural option in modelling DNA and as a potential binding site, where it could have a role in DNA replication, nuclease resistance, ssDNA genome packaging and centromere function.