Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.     

The source of ochratoxin A in Brazilian coffee and its formation in relation to processing methods

A total of 408 Brazilian coffee samples was examined during the 1999 and 2000 coffee harvest seasons for the presence of ochratoxin A (OA) and fungi with the potential to produce it. Samples came from four regions: Alta Paulista (western area of S?o Paulo State), Sorocabana (southwest S?o Paulo State), Alta Mogiana (northeast S?o Paulo State) and Cerrado Mineiro (western area of Minas Gerais State). Cherries and beans were examined at different stages: immature, mature and overripe cherries from trees, overripe cherries from the ground and beans during drying and storage on the farm. For mycological studies, the cherries and beans were surface disinfected with chlorine, plated on Dichloran 18% Glycerol Agar at 25 degrees C for 5-7 days and analysed for the presence of Aspergillus ochraceus and closely related species, A. carbonarius and A. niger. More than 800 isolates of fungi belonging to these species were identified and studied for the ability to produce OA using the agar plug technique and thin layer chromatography (TLC). A. niger was the species found most commonly (63% of isolates of these three species), but only 3% of them produced OA. A. ochraceus also occurred commonly (31% of isolates), and 75% of those studied were capable of OA production, a much higher percentage than reported elsewhere. A. carbonarius was found (6% of isolates) only in Alta Paulista, the hottest region studied, and only from beans in the drying yard or in storage. However, 77% of the A. carbonarius isolates were capable of producing OA. Average infection rates for cherries taken from trees were very low, but were higher in fruit taken from the ground, from the drying yard and from storage, indicating infection by toxigenic species after harvest. The average OA content in 135 samples of mature cherries from trees, overripe from trees, overripe from the ground, drying yard and storage was 0.1, <0.2, 1.6, 2.1 and 3.3 microg/kg, respectively. Although individual OA levels varied widely, only 9 of the 135 samples analysed exceeded 5 microg/kg OA, with one sample of poor quality dried coffee in excess of 100 microg/kg OA. The causes of high contamination were investigated on the farms concerned and several critical points were found, relating both to local climatic conditions and the drying processes used.     

Detection of ochratoxin A in animal feeds and capacity to produce this mycotoxin by Aspergillus section Nigri in Argentina.

Ochratoxin A (OA) is a mycotoxin detected in a variety of food and feeds mostly from countries with a temperate climate because of the fungi that produce it, mainly Aspergillus ochraceus and Penicillium verrucosum. In Argentina, there is no available information about the natural occurrence of OA and ochratoxigenic fungi from feedstuffs. The aim was to evaluate the natural occurrence of OA in poultry, pig and rabbit feeds over 8 months. Likewise, the capacity to produce OA by Aspergillus section Nigri was investigated. Mycotoxin analysis showed that in some months of sampling, OA was detected in three feeds. OA was found in 38% of the poultry feed samples tested with levels ranging from 25 to 30 ng g(-1). From rabbit feed samples, 25% contained OA and the levels ranged from 18.5 to 25 ng g(-1). Only 13% of the pig feed samples were contaminated with similar levels of toxins. Ninety-four black Aspergillus strains from feedstuffs were tested for OA production. Among these, the tested species were A. niger var. niger, A. niger var. awamori, A. japonicus var. japonicus, A. japonicus var. aculeatus and A. foetidus. For the detection of OA, three methodologies were applied: the two TLC methods used for the fast screening of the filamentous fungi for the production of OA were not sensitive enough to detect OA in any of the black Aspergillus strains. When an HPLC methodology was used, the results showed that 46% of the black Aspergillus strains were producers of OA, with levels ranging from 13 to 25 ng ml(-1) culture medium. The highest percentage of ochratoxicogenic strains was isolated from rabbit feeds with 100 and 78% of A. niger var. niger and A. niger var. awamori, with mean levels of 15.5 and 14.6 ng ml(-1), respectively. From pig feeds, 61% of the A. niger var. awamori were producers of this toxin with mean levels of 16 ng ml(-1). In poultry feeds, the lowest percentage of OA producer strains was detected. The results for the occurrence of OA in feeds from different sampling months depended on storage and humidity-temperature conditions. Therefore, a good storage practice becomes very important to prevent OA production     

Ochratoxin A in red paprika: relationship with the origin of the raw material

The occurrence of ochratoxin A (OA) in paprika elaborated from peppers grown in several countries (Peru, Brazil, Zimbabwe and Spain) was studied, using an immunoaffinity clean-up column coupled to liquid chromatography and fluorescence detection. The preparation of the methyl ester (OA-Me) and liquid chromatography-electrospray-ion trap-mass spectrometry was used both to confirm the identity of the chromatographic peak that correspond to OA and to quantify it at low levels or in dirty fractions. A total of 115 strains of moulds were isolated; 85 of the fungal strains were obtained from OA contaminated paprika samples and identified as belonging to the Aspergillus Section Circumdati group (A. ochraceus) and Section Nigri group (A. niger, A. carbonarius). Among the latter ones, 31% of the A. ochraceus isolates and one A. niger were OA producers in vitro. None of the mould strains isolated from paprika samples with undetectable levels of OA or concentrations below 1 microg kg(-1) were toxin producers. Great differences in OA content in paprika samples were found, and a relationship with the climatic conditions of the geographic origin of the samples, and with cultural and technical practices in pepper manipulation is suggested.     

Production of ochratoxin A by Aspergillus carbonarius on coffee cherries

Robusta coffee cherries collected before and during sun drying from two coffee farms in Thailand were examined for moulds producing ochratoxin A (OA). Aspergillus ochraceus was only detected in one sample, whereas Aspergillus carbonarius was isolated from 7 out of 14 samples. On gamma-irradiated coffee cherries, each of the six tested A. carbonarius strains produced OA. More than 4800 microg kg(-1) of toxin were detected under optimal conditions (25 degrees C, a(w) 0.99). OA production was strongly reduced (230 microg kg(-1)) at an a(w) of 0.94.     

Isolation, identification and toxigenic potential of ochratoxin A-producing Aspergillus species from coffee beans grown in two regions of Thailand

In 2006 and 2007, 32 Thai dried coffee bean samples (Coffea arabica) from two growing sites of Chiang Mai Province, and 32 Thai dried coffee bean samples (Coffea canephora var. robusta) from two growing sites of Chumphon Province, Thailand, were collected and assessed for the distribution of fungi with the potential to produce ochratoxin A (OTA). The overall percentage of fungal contamination in coffee was 98% and reduced to 60% after surface disinfection. There were remarkable ecological differences in the composition of ochratoxigenic species present in these two regions. Arabica coffee bean samples from the North had an average of 78% incidence of colonization with Aspergillus of section Circumdati with Aspergillus westerdijkiae and A. melleus as the predominant species. Aspergillus spp. of section Nigri were found in 75% of the samples whereas A. ochraceus was not detected. Robusta coffee beans from the South were 98-100% contaminated with predominantly A. carbonarius and A. niger. A. westerdijkiae was only found in one sample. The diversity of the fungal population was probably correlated with the geographical origin of the coffee, coffee cultivar, and processing method. Representative isolates of section Circumdati (52) and Nigri (82) were examined for their OTA production using HPLC with fluorescence detection. Aspergillus westerdijkiae (42 isolates out of 42), A. steynii (13/13), and A. carbonarius (35/35) in general produced large amounts of OTA, while one isolate of A. sclerotiorum produced intermediate amounts of OTA. 13% of the A. niger isolates produced OTA in intermediate amounts. OTA levels in coffee bean samples were analyzed using the Ridascreen OTA ELISA kits. Of the 64 coffee bean samples analyzed, 98% were contaminated with OTA in levels of <0.6-5.5 microg/kg (Arabica) and 1-27 microg/kg (Robusta). Presence of OTA in representative coffee samples was also confirmed by LC-MS/MS after ion-exchange purification.     

Inactivation of A. ochraceus spores and detoxification of ochratoxin A in coffee beans by gamma irradiation

Ochratoxin A (OTA) produced in food by Aspergillus ochraceus is known to cause adverse health effects. Among the plantation products, green coffee beans are prone to fungal attack and get contaminated with OTA frequently. A fungal strain isolated from green coffee beans was characterized by morphological analyses as well as internal transcribed spacer (ITS) and 5.8S rDNA sequencing, turned out to be A. ochraceus, however, nontoxigenic. Hence, additional strains of A. ochraceus were procured and characterized for toxin production. Presterilized green coffee beans were spiked with a toxigenic strain and treated with gamma radiation. Minimum inhibitory dose (MID) of gamma radiation for 10(4) and 10(8) spores of A. ochraceus strain per 10 g of green coffee beans was found to be approximately 1 and approximately 2.5 kGy, respectively. The radiation treatment (10 kGy) almost degraded the preformed or in vitro added OTA (50 ppb) in coffee beans. OTA degradation was found to be enhanced with increase in moisture content. Cytotoxicity in terms of cell viability was found to be reduced significantly for radiation treated OTA in MTT [3-(4,5-dimethylthiazole-2yl)-2,5-diphenyl tetrazolium bromide] assay as well as flow cytometric analysis when studied using human intestinal epithelial (Int-407) cells. Similar finding was also observed with E. coli MG1655 cells. Thus the inclusion of gamma radiation treatment in the postharvest processing chain of green coffee beans could help in eliminating toxigenic fungi as well as destroying preformed OTA without affecting the sensory attributes. PRACTICAL APPLICATION: In general, mycotoxins including ochratoxin A (OTA) are highly stable to detoxifying agents. Green coffee beans are prone to fungal attack and could get frequently contaminated with the OTA due to improper drying or rehydration during storage. Gamma radiation processing of green coffee beans was found to eliminate the A. ochraceus spores as well as inactivate OTA without affecting its sensory attributes. Thus inclusion of gamma radiation in the postharvest processing chain of green coffee beans would be very useful for consumer safety and coffee trade.     

Effect of the post-harvest processing procedure on OTA occurrence in artificially contaminated coffee

The purpose of this work was to study how the type of post-harvest process, i.e. natural preparation known as the dry method, and two wet processes, affected contamination and toxin production up to the green coffee stage. Batches were contaminated with ochratoxin A or with OTA-producing strains of Aspergillus ochraceus and Aspergillus niger. For OTA artificial contamination, hulling or husk removal caused a reduction of OTA. When A. ochraceus was inoculated at low level, its growth was hampered by indigenous mould flora contrary that observed with A. niger. The fungal counts and OTA assays showed that the best way of limiting the development and impact of contaminating toxigenic flora "from the field" was the physical wet method.     

Incidence of microflora and of ochratoxin A in green coffee beans (Coffea arabica).

Coffee is produced in tropical countries around the Equator where climatic conditions are favourable for fungal development and mycotoxin production; however, mycotoxins do not only occur in the tropical countries. The aim was to evaluate the mycoflora and possible incidence of ochratoxin A (OTA) in 60 samples of green coffee beans from Brazil. The mycological evaluation was carried out using a conventional method and the OTA was determined using sequential phenyl silane and immunoaffinity column cleanup followed by HPLC. The detection limit was 0.2 microg kg(-1). Practically all samples (91.7%) were contaminated with moulds. The dominant fungal genus was Aspergillus, including A. niger (83.3%), A. ochraceus (53.3%) and A. flavus (25.0%). The occurrence and the levels of the genus Cladosporium (16.6%) and Penicillium (10.0%) were substantially lower than Aspergilli. Twenty samples (33.3%) of 60 were contaminated with the toxin at levels ranging from 0.2 to 7.3microg kg(-1). The average concentration was 2.38 microg kg(-1). All positive samples showed OTA levels below the limit suggested by the European Union (8 microg kg(-1)).     

Current importance of ochratoxin A-producing Aspergillus spp

Ochratoxin A (OA) is receiving attention worldwide because of the hazard it poses to human and animal health. OA contamination of commodities, such as cereals or pork and poultry meat, is well recognized. Nevertheless, there is an increasing number of articles reporting OA contamination in other food commodities, such as coffee, beer, wine, grape juice, and milk, in the last few years. This continuous and increasing exposure to OA that humans experience is reflected in the high incidence of OA in both human blood and milk in several countries. OA was believed to be produced only by Aspergillus ochraceus and closely related species of section Circumdati and by Penicillium verrucosum; however, in the genus Aspergillus, the production of OA has been recently reported by species outside the section Circumdati. Thus, it has been clearly established as a metabolite of different species of the section Nigri, such as Aspergillus niger and Aspergillus carbonarius. OA production ability by Aspergillus spp. is more widespread than previously thought; therefore, there is the possibility that unexpected species can be new sources of this mycotoxin in their natural substrates.     

Modelling of effects of water activity and temperature on germination and growth of ochratoxigenic isolates of Aspergillus ochraceus on a green coffee-based medium

Influence of water activity (0.75-0.99 a(w)) and temperature (10, 20 and 30 degrees C) on germination and mycelial growth on green coffee extract agar medium of three ochratoxigenic isolates of Aspergillus ochraceus was studied. Optimal conditions for germination and growth were observed at 0.95-0.99 a(w) and 20-30 degrees C for the three isolates. Minimum a(w) level for germination was 0.80, and 0.85 for mycelial growth. At marginal a(w) and temperature levels assayed, the lag phases prior to germination increased and the growth rates showed a significant decrease in comparison with the optimal conditions. Data were modelled by a multiple linear regression (MLR) and response surface models were obtained. Germination and growth of A. ochraceus in green coffee beans could be prevented or at least inhibited to some extent by minimising the time that coffee beans are exposed to temperature and humidity conditions near to the optimum during processing and storage. This could be an empirical approach to predict the effects of water activity and temperature conditions on the development of ochratoxigenic isolates of A. ochraceus during handling and storage of green coffee.     

Mycoflora and ochratoxin A producing strains of Aspergillus in Algerian wheat

Wheat is a basic staple food for very large segments of the population of Algeria. The aim of this study is to analyse ochratoxin A (OTA)-producing mould and OTA-contaminated wheat. To evaluate the mycoflora and the potential for OTA production by Aspergillus strains, a total of 85 samples of wheat destined for human consumption were collected from two regions in Algeria (Tizi Ouzou and Setif) during the following phases: preharvest, storage in silos, and after processing. The mean value counts of fungi ranged from 275 to 1277 CFU g(-1). The dominant genus was Aspergillus, predominantly A. flavus, A. niger and A. versicolor. The other isolated species were A. ochraceus, A. alliaceus, A. carbonarius, A. terreus, A. fumigatus, A. candidus and Aspergillus spp. The occurrence and the levels of the genus Penicillium, Fusarium, Alternaria and Mucor were substantially lower than those of Aspergillus. The storage in silos shows high levels of Aspergillus (66 to 84%), especially A. flavus, but A. niger and other fungi were isolated at relatively low percentages. Equal distribution of the fungal contamination into the bran, flour and semolina fractions was observed from Flour Mill and Semolina Mill. The genus Aspergillus remained present at high levels at several phases of the production process. In addition, the ability to produce OTA by 135 isolates belonging to eleven species of Aspergillus and 23 isolates of Penicillium spp. was analyzed using fluorescent detection-based HPLC. Thus, it was found that 51 isolates (32.3%) were ochratoxigenic. All isolated strains of A. ochraceus (12) and A. alliaceus (6) produced OTA at concentrations ranging from 0.23 to 11.50 microg g(-1). Most of the A. carbonarius strains (80%) were OTA producers (0.01 to 9.35 microg g(-1)), whereas A. terreus (50%), A. niger (28%), A. fumigatus (40%), A. versicolor (18%) and Penicillium spp. (21.7%) were low level producers (0.01 to 0.07 microg g(-1)). The concentration of OTA was determined in 30 samples of wheat. OTA was detected in 12 (40%) of the samples at levels ranging from 0.21 to 41.55 microg kg(-1).     

Toxigenic fungi isolated from dried vine fruits in Argentina

To evaluate the potential for mycotoxin production by fungi in dried vine fruits, the mycobiota was determined both before and after surface disinfection. Predominant genera were Aspergillus (50.2%), Eurotium (21.4%) and Penicillium (13.5%). Aspergillus section Nigri ("black aspergilli") were isolated with relatively high frequency. Aspergillus niger was the most common species but only 3 of 293 isolates screened were ochratoxin A (OTA) producers. Aspergillus carbonarius was less common but 96% of 48 strains screened were ochratoxigenic. OTA was not produced by A. japonicus. Other toxigenic fungi detected were A. ochraceus (3 strains produced OTA), Aspergillus flavus (5 strains produced cyclopiazonic acid but not aflatoxins), P. citrinum (19 strains were strong citrinin producers) and Alternaria alternata (15 strains were producers of tenuazonic acid, alternariol and alternariol methyl ether). In spite of the high incidence of A. carbonarius capable of producing OTA, low levels of this toxin were detected in the samples analysed.     

Black Aspergillus species as ochratoxin A producers in Portuguese wine grapes

To evaluate the incidence of fungi producing ochratoxin A (OA) in Portuguese wine grapes, a survey was conducted in 11 vineyards, from four winemaking regions each with distinct climatic conditions. From setting to the harvesting period, a total of 1,650 berries were sampled by plating methods. Out of 370 aspergilli and 301 Penicillium strains isolated, 14% of the aspergilli were OA-producing strains. None of the penicillia were OA-producing strains. The black aspergilli were predominant (90%). All Aspergillus strains were tested in vitro for OA production and all were preserved in the Micoteca da Universidade do Minho (MUM) culture collection. Most of the Aspergillus carbonarius (97%) and 4% of the Aspergillus niger aggregate strains were OA producers. Almost all ochratoxigenic strains were isolated at harvest time, mainly in the regions with a Mediterranean climate. In the vineyards sampled, the percentage of colonized berries with ochratoxigenic strains was up to 38%. The vineyards from the region with Atlantic influences, with high rainfall, exhibited the lowest occurrence of Aspergillus and ochratoxigenic strains, 0% to 10% and 0% to 2% colonized berries, respectively. Data obtained here supports the hypothesis that A. carbonarius and occasionally A. niger, are the main producers of OA in grapes. In this study, the highest incidence of these fungi occurred in vineyards with a Mediterranean climate.     

Development of a flow-through enzyme immunoassay and application in screening green coffee samples for ochratoxin A with confirmation by high-performance liquid chromatography

A flow-through enzyme immunoassay has been developed for the screening of green coffee bean samples for ochratoxin A (OA) and was later used in a survey on OA in green coffee from different countries. The test has a sensitivity of 8 ng/g, and calculated recoveries ranged from 70 to 89% and from 86 to 95% for spiked and naturally contaminated samples, respectively. There were no significant differences in within-day and between-day assay performance (P > 0.05). Green coffee samples (15 Arabica and 7 Robusta) received from an international coffee trader were analyzed for intrinsic fungal contamination, screened for OA, and subsequently confirmed by high-performance liquid chromatography (HPLC). All 22 samples were contaminated by fungal species of the genus Aspergillus, while Penicillium species were isolated from a mere 13.6% of the total number of samples. Isolates were tested for their ability to produce OA, and only 3.9% were positive. There was no correlation between occurrence of OA-producing isolates and levels of OA in contaminated samples. Results of the screening procedure showed that 4 of the 22 samples were contaminated with 8 ng/g or higher. The HPLC method confirmed that the OA levels ranged from 27 to 168 ng/g. A fifth sample, which was shown to be negative during screening, had an OA concentration of 4 ng/g. There were no false negatives or positives recorded, and the flow-through enzyme immunoassay results correlated with those obtained by HPLC.     

Non-specificity of nutritional substrate for ochratoxin A production by isolates of Aspergillus ochraceus

Aspergillus ochraceus is an important contaminant of diverse substrates, such as cereals, coffee, grapes and derivates. This fungus produce a nephrotoxic metabolite, ochratoxin A (OTA), whose presence on food and feeds may be an important risk for animal and human health. The aim of this work was to evaluate the significance of the origin of A. ochraceus isolates on their OTA production patterns on different substrates (yeast extract sucrose (YES) broth, irradiated barley grains, irradiated green coffee beans and sterilized grapes) and under different environmental conditions. Results did not show a significant influence of the isolation source on OTA-production profiles by A. ochraceus isolates on several substrates, since the isolates which produced the highest OTA amounts in vitro (YES medium) were also the isolates with the highest OTA yields on the other substrates. Abiotic factors assayed (water activity, temperature and substrate) affected significantly OTA productions by A. ochraceus. Maximum OTA amounts were detected at 25 degrees C and 0.98 a(w) on all substrates tested. The highest OTA accumulations found on the different substrates were: green coffee beans (> 2 mg g(-1)), barley grains (approximately 1 mg g(-1)), YES medium (13.9 microg ml(-1)) and grape (approximately 3 ng g(-1)).     

Mycological survey for potential aflatoxin and ochratoxin producers and their toxicological properties in harvested Brazilian black pepper.

A mycological survey was carried out on 115 samples of whole dried black pepper seeds, from two main production regions of Brazil (Pará and Espírito Santo). A high incidence of contamination was verified in both regions when 99.1% of the samples showed filamentous fungi contamination. A total of 497 species of nine different genera were isolated (Aspergillus, Eurotium, Rhizopus, Penicillium, Curvularia, Cladosporium, Absidia, Emericella and Paecilomyces). The genus Aspergillus was the predominant (53.5%) followed by species from the Eurotium genus (24.5%). Eurotium chevalieri (16.4%) was the most predominant species followed by A. flavus (14.6%) present on 55 samples of black pepper (47.8%) analysed. Twenty-five samples (21.7%) were contaminated with aflatoxigenic strains of A. flavus and A. parasiticus. In relation to the types of aflatoxins produced by mycotoxigenic strains, it was observed that 25 strains (44.6%) of 56 isolated of A. flavus produced aflatoxins. From 12 samples, A. ochraceus species were isolated in low frequency (3.5%). Two strains of A. ochraceus from 16 isolated were producers of ochratoxin A. With respect to the aflatoxins and ochratoxin A natural contamination, none of the samples presented detectable levels of these mycotoxins using thin-layer chromatographic analysis.     

Effect of water activity and temperature on mycelial growth and ochratoxin A production by isolates of Aspergillus ochraceus on irradiated green coffee beans

Aspergillus ochraceus as a fungal contaminant and ochratoxin A (OTA) producer plays an important role in coffee quality. Temperature and water activity (a(w)) significantly influence mycelial growth and OTA production by isolates of A. ochraceus on green coffee beans. Maximum mycelial growth was found at 30 degrees C and 0.95 to 0.99 a(w). A marked decrease in growth rate was observed when temperature and a(w) were reduced. At 0.80 a(w), mycelial growth occurred only at 30 and 20 degrees C for one isolate. Maximum OTA production was found at 20 degrees C and 0.99 a(w). At 10 degrees C, OTA was not produced, regardless of a(w). Similarly, no OTA was detected at 0.80 a(w). OTA production ranged from the limit of detection (40 ng g(-1) of green coffee) to 17,000 ng g(-1) of green coffee. Significant intraspecific differences in mycelial growth and OTA production were found. Primary data for lag phases prior to mycelial growth under the influence of temperature and a(w) were modelled by multiple linear regression, and the response surface plots were obtained.     

The mycobiota of coffee beans and its influence on the coffee beverage

The quality of coffee beverage is influenced by several factors, including the species or botanical variety of the beans, agricultural practices, harvesting, drying and storage techniques and also the preparation of the beverage. Apart from these, there is the input of microbial contamination during the processing of the beans. Numerous studies have demonstrated that fungi are important contaminants of coffee beans, especially just after harvesting and drying. However, the relationship between fungal contamination and the sensorial characteristics of the beverage has yet to be described. The aim of this research was to analyze the mycobiota of coffee beans collected from different stages of the coffee production chain and to correlate these data with the sensorial characteristics of the final beverage. Fungal infection of 22 coffee bean samples from the southwest of São Paulo state was analyzed. Samples were collected from the tree (mature cherries), from the ground, from the patio (mature, immature and dried floaters or overripe cherries from the tree) and from storage facilities. In general, coffee samples from this region showed high fungal infection and contamination was higher than 70% in about 45% of the samples. A high diversity of fungi was isolated from all the coffee samples analyzed and the most common were Penicillium brevicompactum, Aspergillus section Nigri, Penicillium sp. nov. (closely related to Penicillium crustosum) and Fusarium sp. Both P. brevicompactum and Penicillium sp. nov. were found at all processing stages, including in the cherries, showing that these fungi are naturally found in the coffee beans from this region. Floater coffee and coffee from the ground showed negative sensorial evaluation with attributes such as moldy, dirty and fermented and presented a high contamination by Aspergillus section Nigri and Aspergillus westerdijikiae.     

Occurrence of ochratoxin A in wine and ochratoxigenic mycoflora in grapes and dried vine fruits in South America

Grape and wine production in South America represents about 6.6% and 10% respectively of the world grape and wine production. The available information on the ochratoxigenic mycoflora and ochratoxin A (OTA) presence in wine grapes, wines, grape juices and dried vine fruits is limited. Surveys have been carried out in Argentina and Brazil which showed that Aspergillus niger aggregate are predominant in the Argentinean varieties while from the Brazilian varieties the species A. niger, Aspergillus ochraceus and Aspergillus carbonarius were isolated. A mycobiota survey from wine grapes in Argentina showed that while Alternaria alternata was predominant, Aspergillus section Nigri species were isolated from 60% of samples. About 41% of black Aspergilli isolates produced OTA with levels ranging from 2 to 24.5 ng mL(-1). In another study, about 83% of A. carbonarius isolates from dried vine fruits produced OTA, with levels ranging from 2 to 5200 ng mL(-1). A survey of grape juices and wines of Brazilian, Argentinean and Chilean origin were found to contain very low levels of OTA. Studies are in progress in Latin America on the ecophysiology of ochratoxigenic fungi and OTA occurrence to reduce the impact of this toxin in the food chain.