Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Management of type 1 diabetes in adolescence is a complex task requiring self-control within individual and interpersonal domains. This is similarly requisite for academic achievement. Grade point average (GPA) was examined as a barometer of diabetes management reflective of self-control in a challenging daily context. Adolescents with type 1 diabetes (n = 172) completed questionnaires on self-control, self-efficacy, parent/peer relationships, and adherence, while mothers reported GPA. Self-control, self-efficacy, and parent/peer relationships predicted GPA, adherence and HbA1c. GPA predicted HbA1c above and beyond adherence and self-control predictors. GPA may be a valuable indicator of individual and interpersonal self-control processes required for diabetes management. 相似文献
Clinical Rheumatology - This study aims to assess rheumatologists’ perceptions, utilization patterns, and attitudes towards the modified New York (mNY) criteria for ankylosing spondylitis... 相似文献
Copy number variation (CNV) contributes to disease and has restructured the genomes of great apes. The diversity and rate of this process, however, have not been extensively explored among great ape lineages. We analyzed 97 deeply sequenced great ape and human genomes and estimate 16% (469 Mb) of the hominid genome has been affected by recent CNV. We identify a comprehensive set of fixed gene deletions (n = 340) and duplications (n = 405) as well as >13.5 Mb of sequence that has been specifically lost on the human lineage. We compared the diversity and rates of copy number and single nucleotide variation across the hominid phylogeny. We find that CNV diversity partially correlates with single nucleotide diversity (r2 = 0.5) and recapitulates the phylogeny of apes with few exceptions. Duplications significantly outpace deletions (2.8-fold). The load of segregating duplications remains significantly higher in bonobos, Western chimpanzees, and Sumatran orangutans—populations that have experienced recent genetic bottlenecks (P = 0.0014, 0.02, and 0.0088, respectively). The rate of fixed deletion has been more clocklike with the exception of the chimpanzee lineage, where we observe a twofold increase in the chimpanzee–bonobo ancestor (P = 4.79 × 10−9) and increased deletion load among Western chimpanzees (P = 0.002). The latter includes the first genomic disorder in a chimpanzee with features resembling Smith-Magenis syndrome mediated by a chimpanzee-specific increase in segmental duplication complexity. We hypothesize that demographic effects, such as bottlenecks, have contributed to larger and more gene-rich segments being deleted in the chimpanzee lineage and that this effect, more generally, may account for episodic bursts in CNV during hominid evolution.Sequence and assembly of great ape reference genomes have consistently revealed that copy number variation (CNV) affects more base pairs than single nucleotide variation (SNV) (Cheng et al. 2005; The Chimpanzee Sequencing and Analysis Consortium 2005; Locke et al. 2011). Segmental duplications, in particular, have disproportionately affected the African great ape (human, chimpanzee, and gorilla) lineages, where they appear to have accumulated at an accelerated rate (Cheng et al. 2005; Marques-Bonet et al. 2009). This has led to speculation that differences in fixation and copy number polymorphism may have contributed to the phenotypic “plasticity” and species-specific differences between humans and great apes (Olson 1999; Varki et al. 2008). While there is some evidence that fixed deletions and duplications contribute to morphological differences between humans and great apes (McLean et al. 2011; Charrier et al. 2012; Dennis et al. 2012), a comprehensive assessment of these differences at the level of the genome has not yet been performed. Previous studies of CNV have been predominated by array comparative genomic hybridization (CGH) experiments (Fortna et al. 2004; Perry et al. 2006; Dumas et al. 2007; Gazave et al. 2011; Locke et al. 2011), which provide limited size resolution, are imprecise in absolute copy number differences, and are biased by probes derived from the human reference genome. Comparisons of reference genomes have been complicated by assessments of a single individual and distinguishing CNVs from assembly errors (The Chimpanzee Sequencing and Analysis Consortium 2005; Locke et al. 2011; Ventura et al. 2011; Prüfer et al. 2012). Here, we compare the evolution and diversity of deletions, duplications, and SNVs in 97 great ape individuals sequenced to high coverage (median ∼25×) (Prado-Martinez et al. 2013). The set includes multiple individuals from the four great ape genera, including Bornean and Sumatran orangutans, each of the four recognized chimpanzee subspecies, bonobos, and both Eastern and Western gorillas, in addition to 10 diverse humans and a high-coverage archaic Denisovan individual. This data set provides unprecedented genome-wide resolution to interrogate multiple forms of genetic variation and a unique opportunity to directly compare mutational processes and patterns of diversity in great apes. 相似文献
Systemic inflammation and increased matrix metalloproteinase (MMP) cause elastin degradation leading to abdominal aortic aneurysm (AAA) expansion. Several prospective studies report that statin therapy can reduce AAA expansion through anti-inflammation. We hypothesize that monocyte activity plays a pivotal role in this AAA development and this study examines patient peripheral blood monocyte cell adhesion, transendothelial migration, and MMP concentrations between AAA and non-AAA patients.
Materials and methods
Peripheral blood was collected and monocytes isolated from control (n = 15) and AAA (n = 13) patients. Monocyte adhesion, transmigration, and permeability assays were assessed. Luminex assays determined MMP-9 and tissue inhibitor of metalloproteinase-4 (TIMP-4) concentrations from cell culture supernatant and patient serum.
Results
AAA patient monocytes showed increased adhesion to the endothelium relative fluorescence units (RFU, 0.33 ± 0.17) versus controls (RFU, 0.13 ± 0.04; P = 0.005). Monocyte transmigration was also increased in AAA patients (RFU, 0.33 ± 0.11) compared with controls (RFU, 0.25 ± 0.04, P = 0.01). Greater numbers of adhesive (R2 = 0.66) and transmigratory (R2 = 0.86) monocytes were directly proportional to the AAA diameter. Significantly higher serum levels of MMP-9 (2149.14 ± 947 pg/mL) were found in AAA patients compared with controls (1189.2 ± 293; P = 0.01). TIMP-4 concentrations were significantly lower in AAA patients (826.7 ± 100 pg/mL) compared with controls (1233 ± 222 pg/mL; P = 0.02). Cell culture supernatant concentrations of MMP and TIMP from cocultures were higher than monocyte-only cultures.
Conclusions
Monocytes from AAA patients have greater adhesion and transmigration through the endothelium in vitro, leading to elevated MMP-9 levels and the appropriate decrease in TIMP-4 levels. The ability to modulate monocyte activity may lead to novel medical therapies to decrease AAA expansion. 相似文献
Objective:compare the habits and features of obese (BMI〉25) and normal (BMI〈25) individuals and express a method to ameliorate the life styles using a cross-sectional experiment. Methods:A total of 220 randomly selected cases were divided into case group (n= 110) and control group (n= 100) according to the calculated BMI level. Samples with BMI〉25 kg/m^2 were assigned to the case (obsess) group and those with BMI ranging from 20 to 25 were assigned to control (normal) group. The Miller-Smith life style questionnaires consisting 20 questions each with 5 different answers were given to both groups. Data of the questionnaires were collected and analyzed using t-test and Chi-square with SPSS. Results:No significant differences were found among the two groups in terms of the mean age, gender, level of education, marital status, insurance, breakfast, lunch or dinner, fried meat, legumes, eaffeinated beverages, the length of sleep during 24 h, cigarette smoking and losing job or spouse. However, in regards to use of vegetables, sausage, fried potatoes, enriched breads, low fat milk, low salt, candies and chocolates significant relations were found (P〈0.05). Conclusion: The present study suggests one way to control obesity and prevent diseases is to ameliorate the life styles. There is a relation between health and stress and irregularity of meals, such as breakfast skipping, is associated with overweight and obesity in adolescence. 相似文献
Objective: To explore how relaxation reduce the effect of stress in Iranian nursing students. Methods: A total of 40 nursing students were randomly selected and divided into two groups of test and control each with 20 students. An exam questionnaire consisting of the stress test of Spilberger and control of physiological determinants (blood pressure, pulse respiration, temperature) was performed to two groups. The practice of relaxation continued for two weeks and three times a day. Data were collected and analysed using t-test and Chi-square. Results: Two groups did not show any difference in relation to the average of physiological determinants before and after investigation. However, pulse was significantly different between the two groups. The average scores of stress before and after relaxation were significantly differed between the two groups investigation so that the level of stress was reduced in the test group (t= 2.5, df =39, P= 0.02). Conclusion: To alleviate stressors associated with clinical practice and create a healthy work environment for practice it is recommended that nursing students have some relaxation before entering practical environments. 相似文献
The transmission of malaria by blood transfusion was one of the first transfusion-transmitted infections recorded in the world.
Transfusion-transmitted malaria may lead to serious problems because infection with Plasmodium falciparum may cause rapidly fatal death. This study aimed to compare real-time polymerase chain reaction (real-time PCR) with rapid
diagnostic test (RDT) and light microscopy for the detection of Plasmodium spp. in blood transfusion, both in endemic and non-endemic areas of malaria disease in Iran. Two sets of 50 blood samples
were randomly collected. One set was taken from blood samples donated in blood bank of Bandar Abbas, a city located in a malarious-endemic
area, and the other set from Tehran, a non-endemic one. Light microscopic examination on both thin and thick smears, RDTs,
and real-time PCR were performed on the blood samples and the results were compared. Thin and thick light microscopic examinations
of all samples as well as RDT results were negative for Plasmodium spp. Two blood samples from endemic area were positive only with real-time PCR. It seems that real-time PCR as a highly sensitive
method can be helpful for the confirmation of malaria infection in different units of blood transfusion organization especially
in malaria-endemic areas where the majority of donors may be potentially infected with malaria parasites. 相似文献