A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Epilepsy in patients with insulin-dependent diabetes and relation to glutamic acid decarboxylase 65

Objectives:To report if the association of epilepsy in pediatric patients (below the age of 15 years) with Insulin-dependent Diabetes (IDDM) at King Fahad Medical City (KFMC) is higher than the prevalence of epilepsy in the same age group (who have no IDDM) in our community. Consequently, we would determine if there is a relationship between the presence of epilepsy in diabetic children and the presence of positive antiGAD65 antibodies.Methods:This cohort study included 305 pediatric patients below the age of 15 years with Insulin-dependent Diabetes Mellitus (IDDM). They were randomly recruited at the Pediatric Endocrinology Clinic in KFMC. The patients’ caregivers were given a questionnaire between December 2015 till March 2019 to determine the seizure disorder history. There was also a retrospective review of 214 patients’ files for anti-GAD 65 positivity.Results:Our study found a significant relation between the presence of epilepsy in children with IDDM. Therefore, we could confirm the relationship between the existence of epilepsy in children with IDDM and having positive GAD65 antibodies.Conclusion:Our study supports the presence of consistent relation between having IDDM and having epilepsy in children and between the latter and the presence of positive GAD65 antibodies.

Insulin dependent diabetes Mellitus (IDDM) is a common condition in children and adolescents worldwide and so is epilepsy.1,2 Recently, there were increasing reports suggesting a potential association between having IDDM and the occurrence of epilepsy.3 Their association might represent simply a chance to relate their underlying mechanisms. However, the cause-effect relationship is not fully well defined. Literature from other countries have shown the increased prevalence of seizure disorders in this group of patients.4,5 There are scarce studies in the literature investigating IDDM characteristics contributing to having epilepsy, including positive GAD 65 antibodies. In this study that ran in King Fahad Medical City, Riyadh, Kingdom of Saudi Arabia (KSA) we are aiming to determine if the prevalence of epilepsy among 1DDM children under the age of 15 years (in our center) is higher than controls (same age without IDDM), and to check the positivity of anti-GAD 65 amongst those patients in order to find if there is a relationship between epilepsy in children with diabetes and the presence of positive GAD65 Antibodies.     

An overview of existing mesothelioma registries worldwide,and the need for a US Registry

The association between asbestos exposure, mainly in occupational settings, and malignant mesothelioma has been well established; this has prompted several countries to establish mesothelioma epidemiologic surveillance programs often at the request of national agencies. This review compares currently existing mesothelioma registries worldwide to develop a concept model for a US real-time case capture mesothelioma registry. Five countries were identified with a mesothelioma specific registry, including Italy, France, UK, Australia, and South Korea. All, except the UK, used interviews to collect exposure data. Linkage with the national death index was available or was in future plans for all registries. The registries have limited information on treatment, quality of life, and other patient-centered outcomes such as symptoms and pain management. To thoroughly collect exposure data, “real-time” enrollment is preferable; to maximize the capture of mesothelioma cases, optimal coverage, and a simplified consent process are needed.