A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

Toxic tau: structural origins of tau aggregation in Alzheimer's disease

Alzheimer’s disease is characterized by the extracellular accumulation of the amyloidβin the form of amyloid plaques and the intracellular deposition of the microtubule-associated protein tau in the form of neurofibrillary tangles.Most of the Alzheimer’s drugs targeting amyloidβhave been failed in clinical trials.Particularly,tau pathology connects greatly in the pathogenesis of Alzheimer’s disease.Tau protein enhances the stabilization of microtubules that leads to the appropriate function of the neuron.Changes in the quantity or the conformation of tau protein could affect its function as a microtubules stabilizer and some of the processes wherein it is involved.The molecular mechanisms leading to the accumulation of tau are principally signified by numerous posttranslational modifications that change its conformation and structural state.Therefore,aberrant phosphorylation,as well as truncation of tau protein,has come into focus as significant mechanisms that make tau protein in a pathological entity.Furthermore,the shape-shifting nature of tau advocates to comprehend the progression of Alzheimer’s disease precisely.In this review,we emphasize the recent studies about the toxic and shape-shifting nature of tau in the pathogenesis of Alzheimer’s disease.     

A perception-based study to explore COVID-19 pandemic stress and its factors in Bangladesh

Background and aimsWorldwide the COVID-19 pandemic has accelerated sufferings of mental health and behaviour attitudes of people. Many countries, including Bangladesh, reported suicide as extreme consequences of the psychological burden influenced by COVID-19. The present study explores human stress and its factor influenced by COVID-19 in Bangladesh, which significantly affect the quality of life.MethodsAn online-based questionnaire survey was conducted among 651 adult Bangladeshi populations by capturing socio-demographic information, possible human stress, and consequences of the pandemic. A set of statistical tools such as Pearson's Correlation Matrix (PCM), T-test, Principal Component Analysis (PCA) and Hierarchical Cluster Analysis (HCA) were applied to identify the relationship between different factors and influential factors increasing human stress.ResultsMore than 83% of the participants are facing COVID-19 related mental stress, which results in short temper, sleep disorder, and family chaos. PCA and HCA outcomes indicated a significant relationship between the respondents' opinions and human stress factors, which harmonized with the country's existing scenario. PCM results enlighten the relationship between human stress factors and found financial hardship, cutting back daily spending, and food crisis are interconnected together causes stress. Also, hampering students' formal education and future career plans significantly contribute to mental stress.ConclusionBased on the above findings, it's crucial to introduce a time-oriented strategy and implement precaution monitoring plans for Bangladesh. The rescue plan will help people to manage the pandemic and improve mental health to fight against psychological challenges related to COVID-19 and future pandemics.     

Epilepsy in patients with insulin-dependent diabetes and relation to glutamic acid decarboxylase 65

Objectives:To report if the association of epilepsy in pediatric patients (below the age of 15 years) with Insulin-dependent Diabetes (IDDM) at King Fahad Medical City (KFMC) is higher than the prevalence of epilepsy in the same age group (who have no IDDM) in our community. Consequently, we would determine if there is a relationship between the presence of epilepsy in diabetic children and the presence of positive antiGAD65 antibodies.Methods:This cohort study included 305 pediatric patients below the age of 15 years with Insulin-dependent Diabetes Mellitus (IDDM). They were randomly recruited at the Pediatric Endocrinology Clinic in KFMC. The patients’ caregivers were given a questionnaire between December 2015 till March 2019 to determine the seizure disorder history. There was also a retrospective review of 214 patients’ files for anti-GAD 65 positivity.Results:Our study found a significant relation between the presence of epilepsy in children with IDDM. Therefore, we could confirm the relationship between the existence of epilepsy in children with IDDM and having positive GAD65 antibodies.Conclusion:Our study supports the presence of consistent relation between having IDDM and having epilepsy in children and between the latter and the presence of positive GAD65 antibodies.

Insulin dependent diabetes Mellitus (IDDM) is a common condition in children and adolescents worldwide and so is epilepsy.1,2 Recently, there were increasing reports suggesting a potential association between having IDDM and the occurrence of epilepsy.3 Their association might represent simply a chance to relate their underlying mechanisms. However, the cause-effect relationship is not fully well defined. Literature from other countries have shown the increased prevalence of seizure disorders in this group of patients.4,5 There are scarce studies in the literature investigating IDDM characteristics contributing to having epilepsy, including positive GAD 65 antibodies. In this study that ran in King Fahad Medical City, Riyadh, Kingdom of Saudi Arabia (KSA) we are aiming to determine if the prevalence of epilepsy among 1DDM children under the age of 15 years (in our center) is higher than controls (same age without IDDM), and to check the positivity of anti-GAD 65 amongst those patients in order to find if there is a relationship between epilepsy in children with diabetes and the presence of positive GAD65 Antibodies.     

Pseudoaneurysm in the inferior alveolar artery following a bad split in bilateral sagittal split osteotomy

Pseudoaneurysms in the external carotid artery system are rare, mostly reported in the superficial temporal and facial arteries. The bilateral sagittal split osteotomy has a low incidence of complications requiring emergency interventions. We report the case of a patient with acute bleeding from a pseudoaneurysm of the inferior alveolar artery diagnosed by angiography and treated successfully by super-selective embolization.