Effects of Phyllanthus urinaria extract on HepG2 cell viability and oxidative phosphorylation by isolated rat liver mitochondria

Ethnopharmacological relevance

Phyllanthus urinaria is widely used as anti-inflammatory, anti-diarrheal and hepatoprotective medicines in Asian countries such as India, China and Thailand. In Thailand, Phyllanthus urinaria is traditionally used as an adjuvant or alternative medicine for cancer patients, including liver cancer. However, there is limited scientific evidence supporting its use in cancer particularly hepatocellular carcinoma.

Aim of the study

To investigate the cytotoxic effect of Phyllanthus urinaria extract on human hepatocellular carcinoma HepG2 cells and the effect on oxidative phosphorylation by isolated rat liver mitochondria.

Materials and methods

HepG2 cells and isolated rat liver mitochondria were treated with the 50% methanolic extract of Phyllanthus urinaria. Cytotoxicity of the extract was assessed by trypan blue exclusion and MTT assay. Rates of oxygen consumption of isolated mitochondria were determined with a Clark oxygen electrode.

Results

It was found that the hydromethanolic extract induced cell death of HepG2 cells in a dose-dependent fashion. The IC₅₀ of Phyllanthus urinaria extract measured by trypan blue exclusion and MTT assay were 431 ± 65 μg/ml and 445 ± 62 μg/ml, respectively. Morphological changes of the cells were also observed. With isolated rat liver mitochondria, the extract slightly stimulated mitochondrial state 4 respiration but profoundly depressed state 3 respiration and respiratory control ratio.

Conclusions

The extract impairs energy metabolism by acting as inhibitor of oxidative phosphorylation and weak mitochondrial uncoupler. These mitochondrial effects may play a role in the cytotoxic action of Phyllanthus urinaria extract on HepG2 cells. These results provide preliminary experimental evidence supporting the use of Phyllanthus urinaria against hepatocellular carcinoma and open the possibility of considering this plant an adjunctive medicine for the treatment of this deadly disease.     

The in vitro antiviral property of Azadirachta indica polysaccharides for poliovirus

Ethnopharmacological relevance

Azadirachta indica A. Juss, popularly known as neem, has been extensively used in Ayurvedic medicine by Indian population for over 2000 years. It is used traditionally for the healing of various diseases. Natural products and their derivatives provide an excellent source for new anti-viral drugs.

Aim of the study

The present study aims at evaluating the activity of two polysaccharides (P1 and P2) isolated from the leaves of Azadirachta indica and their chemical sulfated derivatives (P1S and P2S) against poliovirus type 1 (PV-1).

Materials and methods

The cytotoxicity of the compounds was analyzed by MTT and the antiviral effect was determined by plaque reduction assay in different protocols.

Results

The polysaccharides did not show any cytotoxic effects on HEp-2 cells at the highest tested concentration (200 μg/ml) and exhibited significant antiviral activity with inhibitory concentrations (IC₅₀) of 80 μg/ml, 37.5 μg/ml, 77.5 μg/ml, and 12.1 μg/ml for P1, P1S, P2 and P2S, respectively, and the selectivity indexes (SI) ranged from 18 to 131.9. The compounds demonstrated better inhibitory effect when added concomitantly with the virus infection with a dose-dependent curve inhibition. Lesser effect was observed when the compounds were added after viral infection and the least effect at pre-treatment.

Conclusions

We suggested that the polysaccharides obtained from Azadirachta indica act against PV-1 by inhibiting the initial stage of viral replication. Importantly, original polysaccharides showed better virucidal effect than their sulfated derivatives at all tested concentrations. This study provides a scientific basis for the past and present ethnomedical uses of this plant.     

Ethnopharmacology guided screening of traditional Indian herbs for selective inhibition of Plasmodium specific lactate dehydrogenase

Ethnopharmacological relevance

Medicinal plants traditionally used to treat malaria can provide quality leads towards identifying novel anti-malarial drugs. Here we combined this approach with target based drug discovery and explored Plasmodium specific lactate dehydrogenase (LDH) inhibitory activity of 8 Indian plants which are ethnically used to treat malaria.

Methods

LDH from Indian Plasmodium falciparum and Plasmodium vivax strains, were cloned and expressed in Escherichia coli, followed by purification of recombinant enzymes (rPfLDH and rPvLDH respectively). Extracts of 8 plants in different organic and aqueous solvents, were screened for their inhibitory activity on rPfLDH, rPvLDH and mammalian LDHs. Phyllanthus amarus aqueous extract was further tested for in vitro parasiticidal activity.

Results

Aqueous extract of Phyllanthus amarus Schum. and Thonn. and chloroform extract of Murraya koenigii (L.) Spreng. exhibited profound and exclusive inhibitory effect on Plasmodium falciparum LDH (IC₅₀=11.2 μg/ml±0.4) and Plasmodium vivax LDH (IC₅₀=6.0 μg/ml±0.6) respectively. Moreover, Phyllanthus amarus aqueous extract also demonstrated antiplasmodial activity in vitro, on Chloroquine sensitive and resistant strains of Plasmodium falciparum (IC₅₀=7.1 μg/ml±0.5 and 6.9 μg/ml±0.7 respectively).

Conclusion

Target specific screening of traditional herbs used in malaria treatment has proffered Phyllanthus amarus and Murraya koenigii extracts as hits which can optimistically provide novel antimalarial drugs.     

Antimicrobial properties of stem bark extracts from Phyllanthus muellerianus (Kuntze) Excell

Ethnopharmacological relevance

The plants of the genus Phyllanthus (Euphorbiaceae) are widely distributed in most tropical and subtropical countries, and have long been used in folk medicine to treat several diseases. Particularly, Phyllanthus muellerianus (Kuntze) Excell, commonly called “mbolongo” in Cameroon, is used by pygmies baka as a remedy for tetanus and wound infections.

Aim of the study

To investigate the antimicrobial properties of Phyllanthus muellerianus (Kuntze) Excell (family Euphorbiaceae) stem bark used in Cameroon by baka pygmies as a remedy for wound healing and tetanus.

Materials and methods

Aqueous and methanol extracts with and without defatting treatment, were prepared and their activity against Clostridium sporogenes ATCC 3584, Staphylococcus aureus ATCC 6538, Streptococcus mutans ATCC 25175, Streptococcus pyogenes ATCC 19615, Escherichia coli ATCC 10536, Candida albicans ATCC 10231, was evaluated on the basis of the minimum inhibitory concentration (MIC) and the minimum bactericidal-fungicidal concentration (MBC-MFC) by the macrodilution method.

Results

Water extract showed a weak activity against Clostridium sporogenes (MIC 900 μg/mL) and resulted inactive at the tested concentrations against all the other microorganisms. The defatted methanol extract, inactive against Staphylococcus aureus, Escherichia coli, Candida albicans, exhibited a very interesting activity against Clostridium sporogenes and Streptococcus pyogenes (MIC 100 μg/mL and 300 μg/mL, respectively), which seems to validate the use of this plant in pygmies traditional medicine for the treatment of tetanus and wound infections. The activity found against Streptococcus mutans (300 μg/mL), aetiological agent of caries, may suggest a possible use of this plant as natural remedy to prevent dental diseases.

Conclusions

The activity against streptococci and Clostridium sporogenes ATCC 3584, showed by stem bark extracts of Phyllanthus muellerianus, traditionally used by baka pygmies to treat wound infections and tetanus, is reported for the first time.     

Proanthocyanidin-enriched extract from Myrothamnus flabellifolia Welw. exerts antiviral activity against herpes simplex virus type 1 by inhibition of viral adsorption and penetration

Aim of the study

Extracts from the aerial parts of the South African resurrection plant Myrothamnus flabellifolia Welw. have been used traditionally against infections of the upper respiratory tract and skin diseases. A polyphenol-enriched extract was investigated for potential antiviral effects against herpes simplex virus type 1 (HSV-1) and adenovirus, and the underlying mode of action was to be studied.

Materials and methods

Antiviral effects of an acetone-water extract (MF) from Myrothamnus flabellifolia on HSV-1 and adenovirus type 3 were tested in infected Vero cells by plaque reduction assay, MTT test and immunofluorescence. The influence of the extract on the HSV-1 envelope glycoprotein D was shown by Western blot. Organotypic full thickness skin models consisting of multilayer skin equivalents were used for the investigation of MF effects on HSV-1 replication.

Results

MF exhibited strong antiviral activity against HSV-1. The HSV-1-specific inhibitory concentration (IC₅₀) was determined as 0.4 μg/mL and the cytotoxic concentration (CC₅₀) against Vero cells as 50 μg/mL. A selectivity index (SI) (ratio of CC₅₀ to IC₅₀) of approximately 120 was calculated when MF was added to the virus inoculum for 1 h at 37 °C prior to infection. The replication of adenovirus 3 was not affected by MF.MF abolished virus entry into the host cell by blocking viral attachment to the cell surface. When added after attachment at a concentration of >6 μg/mL, the extract also inhibited penetration of HSV-1 into the host cell. Polyphenolic compounds from MF directly interacted with viral particles, leading to the oligomerisation of envelope proteins as demonstrated for the essential viral glycoprotein D (gD). Using organotypic full thickness tissue cultures, it was shown that treatment of HSV-1 infected cultures with the MF resulted in reduced viral spread.

Conclusions

A polyphenol-enriched extract from Myrothamnus flabellifolia strongly acts against HSV-1 by blocking viral entry into the cells.     

Antimicrobial and cytotoxic activities of medicinal plants of the Brazilian cerrado, using Brazilian cachaça as extractor liquid

Ethnopharmacological importance

Many species of plants in the Brazilian cerrado (savanna) are widely used in ethnomedicine. However, the safety and effectiveness of medicinal plants used in communities with little or no access to manufactured drugs should be evaluated.

Aim of the study

Evaluate the antimicrobial and cytotoxic activities of extracts from eight plant species, obtained using Brazilian cachaça as the extractor liquid.

Materials and methods

The extracts were tested against Bacillus subtilis, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Candida parapsilosis, promastigote forms of Leishmania amazonensis, and poliovirus. In addition, cytotoxic activity was assayed in Vero cells and in human erythrocytes.

Results

The plant species Curatella americana, Sclerolobium aureum, and Plathymenia reticulata showed the best activity against yeasts, especially the crude extract of C. americana and its ethyl-acetate fraction. Kielmeyera lathrophyton showed a minimum inhibitory concentration of 250 μg/ml against S. aureus, and was inactive against Gram-negative bacteria. The extract obtained from Annona coriacea showed the best activity against the promastigote forms of Leishmania amazonensis (IC₅₀ = 175 μg/ml). Only C. americana showed potential for antipoliovirus activity. The concentrations of the crude extracts that showed toxicity to VERO cells had CC₅₀ between 31 and 470 μg/ml, and the lyophilized Brazilian cachaça showed a CC₅₀ of 307 μg/ml. None of the extracts showed toxicity against human erythrocytes.

Conclusions

Among the plant species studied, C. americana proved to be effective against microorganisms, especially as an antifungal. The results will help in the search for alternative drugs to be used in pharmacotherapy, and will contribute to establish safe and effective use of phytomedicines in the treatment of infectious diseases.     

In vitro anthelmintic activity of crude extracts of five medicinal plants against egg-hatching and larval development of Haemonchus contortus

Ethnopharmacological relevance

Senna occidentalis, Leonotis ocymifolia, Leucas martinicensis, Rumex abyssinicus, and Albizia schimperiana are traditionally used for treatment of various ailments including helminth infection in Ethiopia.

Materials and Methods

In vitro egg hatch assay and larval development tests were conducted to determine the possible anthelmintic effects of crude aqueous and hydro-alcoholic extracts of the leaves of Senna occidentalis, aerial parts of Leonotis ocymifolia, Leucas martinicensis, Rumex abyssinicus, and stem bark of Albizia schimperiana on eggs and larvae of Haemonchus contortus.

Results

Both aqueous and hydro-alcoholic extracts of Leucas martinicensis, Leonotis ocymifolia and aqueous extract of Senna occidentalis and Albizia schimperiana induced complete inhibition of egg hatching at concentration less than or equal to 1 mg/ml. Aqueous and hydro-alcoholic extracts of all tested medicinal plants have shown statistically significant and dose dependent egg hatching inhibition. Based on ED₅₀, the most potent extracts were aqueous and hydro-alcoholic extracts of Leucas martinicensis (0.09 mg/ml), aqueous extracts of Rumex abyssinicus (0.11 mg/ml) and Albizia schimperiana (0.11 mg/ml). Most of the tested plant extracts have shown remarkable larval development inhibition. Aqueous extracts of Leonotis ocymifolia, Leucas martinicensis, Albizia schimperiana and Senna occidentalis induced 100, 99.85, 99.31, and 96.36% inhibition of larval development, respectively; while hydro-alcoholic extracts of Albizia schimperiana induced 99.09 inhibition at the highest concentration tested (50 mg/ml). Poor inhibition was recorded for hydro-alcoholic extracts of Senna occidentalis (9%) and Leonotis ocymifolia (37%) at 50 mg/ml.

Conclusions

The overall findings of the current study indicated that the evaluated medicinal plants have potential anthelmintic effect and further in vitro and in vivo evaluation is indispensable to make use of these plants.     

Antihypertensive and neuroprotective activities of rhynchophylline: The role of rhynchophylline in neurotransmission and ion channel activity

Ethnopharmacological relevance

Uncaria species (Gouteng in Chinese) have been used as ethnopharmacological medicines to treat ailments of the cardiovascular and central nervous systems. As the main alkaloid constituent of Uncaria species, rhynchophylline has drawn extensive attention in recent years for its antihypertensive and neuroprotective activities, and its pharmacological effects are related to ethnopharmacological medicine properties of Uncaria species.

Aim of the review

This review examined the pharmacological studies and mechanisms of rhynchophylline, with an emphasis on cardiovascular and central nervous system diseases linked to the ethnopharmacological uses of Uncaria species.

Methods

We conducted both an electronic search and a library search of in vivo and in vitro studies. The terms and keywords for the search included rhynchophylline, Uncaria species, Gouteng, pharmacological effects, and mechanism. We focused on the papers, including ours, with studies on all related pharmacological effects and mechanisms of rhynchophylline.

Results

Rhynchophylline was the main constituent of several components identified from Uncaria species. Rhynchophylline mainly acts on cardiovascular and central nervous system diseases, including hypertension, bradycardia, arrhythmia, sedation, vascular dementia, epileptic seizures, drug addiction, and cerebral ischemia. Rhynchophylline also has effects on anticoagulation, inhibits vascular smooth muscle cell proliferation, and has been shown to be anti-endotoxemic. The active mechanisms are related to modulation of calcium and potassium ion channels, protection of neural and neuroglial cells, and regulation of central neurotransmitter transport and metabolism. More studies are necessary to verify the pharmacological activities and determine the exact mechanisms of rhynchophylline activity.

Conclusions

Rhynchophylline treatment of cardiovascular and central nervous system diseases has a strong linkage with traditional concepts and uses of Uncaria species in ethnopharmacological medicine, such as treatment for lightheadedness, convulsions, numbness, and hypertension. As a candidate drug for several cardiovascular and central nervous system diseases, rhynchophylline will attract scientists to pursue the potential pharmacological effects and mechanisms with new technologies. Relatively few clinically relevant studies of rhynchophylline have been conducted. Thus, more in vivo validations and investigations of antihypertensive and neuroprotective mechanisms of rhynchophylline are necessary.     

The antidiarrheal and spasmolytic activities of Phyllanthus emblica are mediated through dual blockade of muscarinic receptors and Ca2+ channels

Aim of the study

This study was aimed at providing the possible mechanisms for the medicinal use of Phyllanthus emblica in diarrhea.

Materials and methods

The in vivo studies were conducted in mice, while isolated rabbit jejunum and guinea-pig ileum were used for the in vitro experiments.

Results

The crude extract of Phyllanthus emblica (Pe.Cr), which tested positive for alkaloids, tannins, terpenes, flavonoids, sterols and coumarins, caused inhibition of castor oil-induced diarrhea and intestinal fluid accumulation in mice at 500-700 mg/kg. In isolated rabbit jejunum, Pe.Cr relaxed carbachol (CCh) and K⁺ (80 mM)-induced contractions, in a pattern similar to that of dicyclomine. The preincubation of guinea pig-ileum with Pe.Cr (0.3 mg/mL), caused a rightward parallel shift in the concentration-response curves (CRCs) of acetylcholine without suppression of the maximum response. While at the next higher concentration (1 mg/mL), it produced a non-parallel rightward shift with suppression of the maximum response, similar to that of dicyclomine, suggesting anticholinergic and Ca²⁺ channel blocking (CCB)-like antispasmodic effect. The CCB-like activity was further confirmed when pretreatment of the tissue with Pe.Cr, shifted the CRCs of Ca²⁺ to the right with suppression of the maximum response, similar to nifedipine or dicyclomine. The activity-directed fractions of Pe.Cr showed a combination of Ca²⁺ antagonist and anticholinergic like components in all fractions but with varying potency.

Conclusion

These results indicate that the Phyllanthus emblica fruit extract possesses antidiarrheal and spasmolytic activities, mediated possibly through dual blockade of muscarinic receptors and Ca²⁺ channels, thus explaining its medicinal use in diarrhea.     

Ethanol extracts of Saururus chinensis suppress ovalbumin-sensitization airway inflammation

Aim of the study

The aerial part of Saururus chinensis has been used in folk medicine to treat several inflammatory diseases in China and Korea. Previously, our group reported that anti-asthmatic activity of an ethanol extract of Saururus chinensis (ESC) might occur, in part, via the inhibition of prostaglandin D₂ (PGD₂) and leukotriene C₄ (LTC₄) production, and degranulation reaction in vitro, as well as through the down-regulation of interleukin (IL)-4 and eotaxin mRNA expression in an in vivo ovalbumin-sensitization animal model. However, the effects of Saururus chinensis on eicosanoid generation, as well as Th2 cytokines and eotaxin production in an in vivo asthma model, have not been fully investigated. Moreover, it has not been determined whether ESC can ameliorate airway inflammation in vivo. In the present study, we investigated the therapeutic activity of Saururus chinensis on ovalbumin (OVA)-sensitized airway inflammation and its major phytochemical compositions.

Materials and methods

Asthma was induced in BALB/c mice by ovalbumin-sensitization and inhalation. ESC (10-100 mg/kg) or dexamethasone (5 mg/kg), a positive control, was administered 7 times orally every 12 h from one day before the first challenge to 1 h before the second challenge. The recruitment of inflammatory cells and hyperplasia of goblet cells were evaluated by H&E and PAS staining. Levels of Th2 cytokines, eotaxin, PGD₂ and LTC₄ were measured to evaluate the anti-inflammatory activity of ESC in OVA-sensitized mice. Contents of major components were analyzed by HPLC using a reversed-phase C18 column.

Results

ESC (10 mg/kg) suppressed allergic airway inflammation by inhibition of the production of IL-4 (P < 0.001), IL-5 (P < 0.05), IL-13 (P < 0.001), eotaxin (P < 0.001), PGE₂ (P < 0.001), LTC₄ (P < 0.001) in lung extract and IgE level (P < 0.001) in the serum. In addition, ESC (50 mg/kg) reduced the infiltration of inflammatory cells and hyperplasia of goblet cells in the lung tissues. The anti-inflammatory effect of ESC was comparable to that of the positive control drug, dexamethasone. Its major phytochemical composition includes manassantin A, B and sauchinone.

Conclusions

These results suggest that ESC decreased inflammation and mucus secretion in the OVA-induced bronchial asthma model, and its anti-asthmatic activity may occur in part via the inhibition of Th2 cytokines and eotaxin protein expression, as well as through prostaglandin E₂ (PGE₂) and leukotriene C₄ (LTC₄) generation. This effects may be attributed particularly to the presence of manassantin A, B and sauchinone major component evidenced by a HPLC analysis.     

Evaluation of the anti-neuraminidase activity of the traditional Chinese medicines and determination of the anti-influenza A virus effects of the neuraminidase inhibitory TCMs in vitro and in vivo

Etnopharmacological relevance

Neuraminidase (NA) inhibitors are currently the most effective drugs to treat influenza A viruses infection. Many traditional Chinese medicines (TCMs) have been used in the clinics to treat influenza. The anti-viral mechanisms of these TCMs and their inhibitory effects towards NA need to be systematically tested.

Aim of the study

To evaluate the anti-NA activity of the TCMs and the anti-influenza A virus effects of the NA inhibitory TCMs in vitro and in vivo.

Material and methods

We tested the inhibitory activity of water extracts from 439 TCMs towards NA. The in vitro anti-influenza virus activities of the 5 TCMs were evaluated using the strain A/California/7/2009 (H1N1) NYMC X-179A of influenza A virus. A randomly selected TCM with NA inhibitory activity, Melia toosendan extract, was further evaluated using a mouse model infected with influenza A virus.

Results

Five TCMs, Duchesnea indica (Andr.) Focke [Fragaria indica Andr.], Liquidambar formosana Hance., Lithospermum erythrorhizon Sieb. et Zucc., Melia toosendan Sieb. et Zucc., and Prunella vulgaris L., exerted potent inhibitory activity towards NA. These TCMs in the range of 25-250 μg/mL had the ability to reduce virus-induced cytopathic effect (CPE) and the virus yield in MDCK cells. Melia toosendan significantly reduced death rate and prolonged mean day to death (MDD) of the viral infected mice.

Conclusions

This study describes five TCMs exerted strong inhibitory activities towards NA, and exhibited antiviral effect against influenza A virus by reducing viral reproduction and reduced CPE of the viral infected cells. Melia toosendan, significantly reduced death rate and prolonged survival of the H1N1 viral infected mice.     

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Ethnopharmacological relevance

Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India.

Aim of the study

To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools.

Materials and methods

Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0.

Results

Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH.

Conclusion

Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.     

Antinociceptive effect of Lecythis pisonis Camb. (Lecythidaceae) in models of acute pain in mice

Ethnopharmacological relevance

Lecythis pisonis Camb., also known in Brazil as sapucaia, is used in folk medicine against pruritus, muscle pain and gastric ulcer.

Aim of the study

To investigate the antinociceptive effect of ethanol extract from Lecythis pisonis leaves (LPEE), fractions (hexane-LPHF, ether-LPEF and ethyl acetate-LPEAF) and mixture of triterpenes [ursolic and oleanolic acids (MT)] in mice.

Materials and methods

LPEE and LPEF were evaluated on the acetic acid induced writhings and formalin, capsaicin and glutamate tests. In addition, MT was investigated on the writhings induced by acetic acid, capsaicin and glutamate tests. In the study of some possible mechanisms involved on the antinociceptive effect of LPEF, it was investigated the participation of opioid system, K⁺_ATP channels and l-arginine-nitric oxide pathway.

Results

LPEE (12.5 and 25 mg/kg, p.o.), LPEF and MT (6.25, 12.5 and 25 mg/kg, p.o.) reduced the writhings in comparison to saline. LPEE (100 mg/kg, p.o.) and LPEF (50 mg/kg, p.o.) were effective in inhibiting both phases of formalin test. In capsaicin test, LPEE (100 and 200 mg/kg, p.o.), LPEF (12.5–50 mg/kg, p.o) and MT (6.25–25 mg/kg, p.o.) showed a significant antinociceptive effect compared to the control. LPEE (25 and 50 mg/kg, p.o.), LPEF (50 and 100 mg/kg, p.o.) and MT (12.5 and 25 mg/kg, p.o.) reduced the glutamate-evoked nociceptive response. Treatment with naloxone, l-arginine and glibenclamide reversed the effect of LPEF in glutamate test.

Conclusions

These results indicate the antinociceptive effect of Lecythis pisonis leaves and suggest that this effect may be related to opioid pathway, K⁺_ATP channels, and l-arginine-nitric oxide modulation. Furthermore, these data support the ethnomedical use of this plant.     

Progallin A isolated from the acetic ether part of the leaves of Phyllanthus emblica L. induces apoptosis of human hepatocellular carcinoma BEL-7404 cells by up-regulation of Bax expression and down-regulation of Bcl-2 expression

Aim of the study

This study was aimed to investigate the effects of Progallin A isolated from the acetic ether part of the leaves of Phyllanthus emblica L. on apoptosis in human hepatocellular carcinoma BEL-7404 cells and its possible mechanisms, and to measure the immune toxicity of Progallin A in vitro.

Materials and methods

Progallin A was isolated from the acetic ether part of the leaves of Phyllanthus emblica L. with column chromatography. The proliferation of spleen lymphocytes and the viability of BEL-7404 cells were assessed with MTT assay. Inverted microscope, light microscope and fluorescence microscope were utilized to observe the morphological changes of BEL-7404 cells respectively. AnnexinV/PI double labeling and TUNEL assay were used to detect early apoptosis and DNA fragmentations of BEL-7404 cells respectively. In addition, cell cycle distribution was analyzed by using flow cytometry (FCM). Bax and Bcl-2 protein levels were determined by immunofluorescence staining and western blot respectively.

Results

The results showed that Progallin A had low immune toxicity and the proliferation of BEL-7404 cells was strongly inhibited by Progallin A in a time- and dose-dependent manner and that the characteristics of apoptosis of BEL-7404 cells were observed. The results also showed that apoptosis rates and the number of apoptotic cells significantly increased with prolongation of the action time. The results of flow cytometry (FCM) indicated that Progallin A induced significant G1/M and G2/M arrest of BEL-7404 cells. Immunofluorescence staining and western blot showed that the expression of Bax was found to be noticeably up-regulated and the expression of Bcl-2 was down-regulated significantly.

Conclusions

These results indicate that Progallin A has low immune toxicity in vitro and induces apoptosis of human hepatocellular carcinoma BEL-7404 cells which is related to the G1/M and G2/M arrest, and it exerts its apoptotic effect by up-regulation of Bax expression and down-regulation of Bcl-2 expression.     

The effects of Sceletium tortuosum in an in vivo model of psychological stress

Aim of the study

Sceletium, and especially Sceletium tortuosum, is traditionally used as masticator and thought to have a sedative effect which may be beneficial to reduce symptoms of anxiety and/or depression. The current study evaluated the scientific merit of these anecdotal claims in an in vivo model of psychological stress.

Materials and methods

Male Wistar rats were administered either placebo, 5 or 20 mg/kg/day of Sceletium tortuosum extract for 17 days by daily oral gavage. 50% of rats were exposed to repeated restraint stress lasting 1 h for the last 3 days of treatment. Rat behavioral changes in response to stress were assessed using the elevated plus maze on the last day of restraint, immediately after the restraint session. Rats were sacrificed 24 h after the last restraint exposure and whole blood collected.

Results

Behavior indicated a limited effect of lower dose Sceletium to decrease restraint stress-induced self-soothing behavior, as well as to decrease stress-induced corticosterone levels. However, increased IL-1β levels argue against the claim that the plant may act as selective serotonin reuptake inhibitor, while this result combined with increased levels of C-reactive protein and prostaglandin E₂ suggest intolerance to the treatment. Decreased IL-2 and increased IL-10 levels in response to Sceletium treatment suggest a suppressive effect on T helper 1 immune function.

Conclusions

Although data indicates a limited positive effect of Sceletium on restraint-induced anxiety, numerous side-effects were evident. More research is required to derive an optimal therapeutic dose.     

Pharmacological actions of the South African medicinal and functional food plant Sceletium tortuosum and its principal alkaloids

Ethnopharmacological relevance

The South African plant Sceletium tortuosum has been known for centuries for a variety of traditional uses, and, more recently, as a possible source of anti-anxiety or anti-depressant effects. A standardised extract Zembrin^® was used to test for pharmacological activities that might be relevant to the ethnopharmacological uses, and three of the main alkaloids were also tested.

Materials and methods

A standardised ethanolic extract was prepared from dried plant material, along with the purified alkaloids mesembrine, mesembrenone and mesembrenol. These were tested on a panel of receptors, enzymes and other drug targets, and for cytotoxic effects on mammalian cells.

Results

The extract was a potent blocker in 5-HT transporter binding assays (IC₅₀ 4.3 μg/ml) and had powerful inhibitory effects on phosphodiesterase 4 (PDE4) (IC₅₀ 8.5 μg/ml), but not other phosphodiesterases. There were no cytotoxic effects. Mesembrine was the most active alkaloid against the 5-HT transporter (K_i 1.4 nM), while mesembrenone was active against the 5-HT transporter and PDE4 (IC₅₀'s < 1 μM).

Conclusions

The activity of the Sceletium tortuosum extract on the 5-HT transporter and PDE4 may explain the clinical effects of preparations made from this plant. The activities relate to the presence of alkaloids, particularly mesembrine and mesembrenone.     

Sheng-Ma-Ge-Gen-Tang (Shoma-kakkon-to) inhibited cytopathic effect of human respiratory syncytial virus in cell lines of human respiratory tract

Ethnopharmacological relevance

Sheng-Ma-Ge-Gen-Tang (SMGGT; Shoma-kakkon-to) has been used against pediatric viral infection for thousands of year in ancient China. However, it is unknown whether SMGGT is effective against human respiratory syncytial virus (HRSV).

Aim of the study

HRSV is a major pediatric viral pathogen of low respiratory tract infection without effective management. This study tested the hypothesis that SMGGT effectively inhibited cytopathy induced by HRSV.

Materials and methods

Effect of the crude extract of SMGGT on HRSV was tested by plaque reduction assay in both human upper (HEp-2) and low (A549) respiratory tract cell lines. Ability of SMGGT to stimulate anti-viral cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA).

Results

Crude extract of SMGGT dose-dependently inhibited HRSV-induced plaque formation. The crude extract was more effective when given before viral infection (p < 0.0001). It inhibited viral attachment dose-dependently (p < 0.0001) and could increase heparin effect on viral attachment. Furthermore, it was synergistic with very low-dose heparin on viral attachment. In addition, the crude extract time-dependently and dose-dependently (p < 0.0001) inhibited HRSV internalization into HEp-2 cells. Epithelial cells secrete IFN-β and TNF-α to counteract viral infection. The crude extract could stimulate epithelial cells to secrete these cytokines beforehand and become resistant to viral infection. It also stimulated IFN-β to defense HRSV after viral inoculation.

Conclusions

Sheng-Ma-Ge-Gen-Tang could be effective to manage HRSV infection in young children.     

Anti-inflammatory effects of Polygala tenuifolia root through inhibition of NF-κB activation in lipopolysaccharide-induced BV2 microglial cells

Ethnopharmacological relevance

The root of Polygala tenuifolia Willd is a well-known traditional Oriental medicine and has been prescribed for treatment of dysfunction in memorial systems and various brain inflammatory diseases. The present study was designed to validate the anti-inflammatory effects of the water extract of Polygala tenuifolia root (WEPT).

Materials and methods

The anti-inflammatory properties of WEPT were studied using lipopolysaccharide (LPS)-stimulated murine BV2 microglia model. As inflammatory parameters, the production of nitric oxide (NO), inducible NO synthase (iNOS), cyclooxygenase (COX)-2, prostaglandin E₂ (PGE₂), tumor necrosis factor (TNF)-α, and interleukin (IL)-1β were evaluated. We also examined the extract's effect on the activity of nuclear factor-kappaB (NF-κB), and toll-like receptor 4 (TLR4) and myeloid differentiation factor 88 (Myd-88) expression.

Results

WEPT suppressed LPS-induced production of NO, PGE₂, and expression of iNOS and COX-2 in a dose-dependent manner, without causing cytotoxicity. It also significantly reduced generation of proinflammatory cytokines, including IL-1β and TNF-α. In addition, WEPT suppressed NF-κB translocation by blockade of IkappaB-α (IκB-α) degradation and inhibited TLR4 and Myd-88 expression in LPS-stimulated BV2 cells.

Conclusions

These results indicate that the inhibitory effects of WEPT on LPS-stimulated inflammatory mediator production in BV2 microglia are associated with suppression of the NF-κB and toll-like receptor signaling pathways. Therefore, Polygala tenuifolia extracts may be useful in treatment of neurodegenerative diseases by inhibition of inflammatory mediator production in activated microglia.